NAME
Bio::Grep::Benchmarks - Bio::Grep Benchmarks
DESCRIPTION
A collection of quick and dirty benchmarks.
BENCHMARKS
2 x Intel(R) Xeon(TM) CPU 2.40GHz, 1GB RAM. Fedora Core 6.
TAIR7_cdna_20070425 (Arabidopsis CDNA Fasta file, 52MB).
Bio::Grep v0.10.2.
Database Generation
Average over 2 iterations.
GUUGle : 10.60 sec
Agrep/RE : 22.44 sec
Vmatch (-pl 3) : 171.53 sec
Mismatches
Query: ugacagaagagagugagcac (revcom)
Average over 20 iterations.
- No mismatches (exact matching):
-
Agrep (Wu-Manber): 0.53 sec Vmatch : 1.72 sec RE : 1.78 sec Vmatch (-online) : 4.38 sec GUUGle : 9.59 sec Agrep (TRE) : 15.96 secNote that
Vmatchneeds one slow run to load the suffix arrays in memory (Values are the average over 20 iterations). Also note that GUUGle allows GU mismatches. - One mismatch:
-
Vmatch : 0.10 sec Agrep (Wu-Manber): 1.09 sec Vmatch (-online) : 4.24 sec Agrep (TRE) : 47.01 sec GUUGle : n/a RE : n/a - Two mismatches:
-
Vmatch : 0.24 sec Agrep (Wu-Manber): 1.41 sec Vmatch (-online) : 4.32 sec Agrep (TRE) : 59.17 sec GUUGle : n/a RE : n/a - Three mismatches:
-
Vmatch : 0.48 sec Agrep (Wu-Manber): 1.68 sec Vmatch (-online) : 4.60 sec Agrep (TRE) : 72.56 sec GUUGle : n/a RE : n/a - Four mismatches:
-
Vmatch : 1.48 sec Agrep (Wu-Manber): 2.05 sec Vmatch (-online) : 5.34 sec Agrep (TRE) : 83.50 sec GUUGle : n/a RE : n/a - Five mismatches:
-
Agrep (Wu-Manber): 2.77 sec Vmatch : 6.13 sec Vmatch (-online) : 8.81 sec Agrep (TRE) : 96.16 sec GUUGle : n/a RE : n/a
FEEDBACK
The script that generated these benchmarks is available in the examples directory of this distribution.
Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.
AUTHOR
Markus Riester, <mriester@gmx.de>
LICENCE AND COPYRIGHT
Copyright (C) 2007-2008 by M. Riester.
This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.