NAME
Bio::Grep::Benchmarks - Bio::Grep Benchmarks
DESCRIPTION
A collection of quick and dirty benchmarks.
BENCHMARKS
Intel(R) Xeon(TM) CPU 2.40GHz, 1GB RAM. Fedora Core 6.
TAIR7_cdna_20070425 (Arabidopsis CDNA Fasta file, 52MB).
Bio::Grep v0.9.2. Average over 10 iterations.
Database Generation
GUUGle : 11.12 sec
Agrep/RE : 22.52 sec
Vmatch (-pl 3) : 171.56 sec
Mismatches
Query: ugacagaagagagugagcac (revcom)
- No mismatches (exact matching):
-
Agrep (Wu-Manber): 0.33 sec Vmatch : 1.63 sec RE : 1.88 sec GUUGle : 9.97 sec Agrep (TRE) : 15.96 secNote that
Vmatchneeds one slow run to load the suffix arrays in memory (Values are the average over 10 iterations). Also note that GUUGle allows GU mismatches. - One mismatch:
-
Vmatch : 0.20 sec Agrep (Wu-Manber): 1.30 sec Agrep (TRE) : 47.01 sec GUUGle : n/a RE : n/a - Two mismatches:
-
Vmatch : 0.20 sec Agrep (Wu-Manber): 1.55 sec Agrep (TRE) : 59.17 sec GUUGle : n/a RE : n/a - Three mismatches:
-
Vmatch : 0.48 sec Agrep (Wu-Manber): 1.55 sec Agrep (TRE) : 72.56 sec GUUGle : n/a RE : n/a - Four mismatches:
-
Vmatch : 1.55 sec Agrep (Wu-Manber): 2.17 sec Agrep (TRE) : 83.50 sec GUUGle : n/a RE : n/a - Five mismatches:
-
Agrep (Wu-Manber): 2.94 sec Vmatch : 6.43 sec Agrep (TRE) : 96.16 sec GUUGle : n/a RE : n/a
FEEDBACK
The script that generated this benchmarks is available in the script directory of this distribution.
Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.
AUTHOR
Markus Riester, <mriester@gmx.de>
LICENCE AND COPYRIGHT
Copyright (C) 2007 by M. Riester. All rights reserved.
This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.